• Users Online: 19
  • Print this page
  • Email this page


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2021  |  Volume : 2  |  Issue : 1  |  Page : 26-32

A study on the ayurveda intervention (Virechana - therapeutic purgation and Rasayana - rejuvenation) on molecular gene expression profiling in familial breast cancer patients


1 Department of PG Studies in Panchakarma, SSBE Society's Shri Shivayogeshwar Rural Ayurvedic Medical College, Hospital and Research Center, Inchal, Karnataka, India
2 Shri KLE BMK Ayurveda Mahavidyalaya, Belgaum, Karnataka, India
3 Karnataka Institute for DNA Research, Dharwad, Karnataka, India

Date of Submission18-Feb-2021
Date of Decision23-Feb-2021
Date of Acceptance02-Mar-2021
Date of Web Publication17-Apr-2021

Correspondence Address:
Pratibha Sambrekar
Research Coordinator, Medical Research Centre, KLE Shri BM Kankanawadi Ayurveda Mahavidyalaya, Belgaum, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/ijaim.ijaim_6_21

Rights and Permissions
  Abstract 


Background: The study was conducted to assess the ayurvedic intervention Virechana - therapeutic purgation and Rasayana - rejuvenation on predisposed familial breast cancer expression profiling of BRCA1 and BRCA2 genes.
Materials and Methods: The total RNA was extracted from blood of five subjects of familial breast cancer predisposition patients using PAX Gene Blood RNA Kit who had undergone the ayurvedic intervention Virechana - therapeutic purgation and Rasayana - rejuvenation therapy. BRCA1 and BRCA2 gene expression was assessed by reverse transcription polymerase chain reaction and quantitative polymerase chain reaction (qPCR). The qPCR-based BRCA1 gene expression results were analyzed for fold variation based on Ct values using the following formula: 2 (−ΔΔCt), where ΔCt is the Ct (GOI) − avg.(Ct (HKG)), GOI is the gene of interest, and HKG is the housekeeping gene.
Results: In one subject (S1), the upregulation (61.82) showed further increase (843.36) by therapeutic purgation and then decreased below the baseline level (11.3) in the rejuvenation phase. In three subjects (S2, S3, and S5), the upregulated genes (1488.87, 15825.9, and 19.16) showed down trend continuously till rejuvenation phase (1.92, 4.17, and 3.97) but not to downregulation. Another subject (S4) showed reversal of genetic expression, i.e., downregulated gene (−1) showed upregulation (237,900.70) continuously throughout the therapy, which is in conformity of the proposed hypothesis, i.e., biopurification (therapeutic purgation) followed by rejuvenation leads to upregulation of gene.
Conclusion: With the available limited and diversified data, it may be concluded that therapeutic purgation followed by rejuvenation (Narasimha Rasayana) therapy exerted effect on gene expression, but further study needs to be conducted with more number of samples.

Keywords: Breast cancer, molecular gene expression, Rasayana, rejuvenation therapy, therapeutic purgation, Virechana


How to cite this article:
Shetty A, Buduru SP, Kulkarni SS, Gai PB, Sambrekar P. A study on the ayurveda intervention (Virechana - therapeutic purgation and Rasayana - rejuvenation) on molecular gene expression profiling in familial breast cancer patients. Indian J Ayurveda lntegr Med 2021;2:26-32

How to cite this URL:
Shetty A, Buduru SP, Kulkarni SS, Gai PB, Sambrekar P. A study on the ayurveda intervention (Virechana - therapeutic purgation and Rasayana - rejuvenation) on molecular gene expression profiling in familial breast cancer patients. Indian J Ayurveda lntegr Med [serial online] 2021 [cited 2021 Oct 21];2:26-32. Available from: http://www.ijaim.com/text.asp?2021/2/1/26/313998




  Introduction Top


Breast cancer is one of the most common cancers noted in women worldwide and also the leading cause of cancer mortality.[1] It represents nearly a 25% of all cancers with an estimated 1.67 million new cancer cases diagnosed in 2012.[2] It is the second most occurring among Indian women (19%) after cervical cancer (30%).[3] Multiple factors are responsible for the occurrence of cancer. Hereditary cancers count to 5%–10%.[4] Inheritance in an autosomal dominant trait indicates the susceptibility to breast cancer; the presence of homozygous modifier genes might further increase the risk of disease. Inheritance of BRCA1 gene mutation confers a 50%–85% lifetime risk for women of developing breast cancers. These mutations are more aggressive and confer a worse overall survival than breast cancers that occur sporadically.[5]

In conventional medicine for the prevention of mutations, they adopt risk-reducing modalities such as oral tamoxifen, prophylactic mastectomy, and salpingo-oophorectomy, the risk reductions are lower and are associated with side effects of hormone withdrawal and infertility, and the risks associated with taking tamoxifen for every 10,000 women are 15 endometrial cancer, 2 uterine sarcoma, 4 cerebravascular events, and 5 pulmonary emboli per year.[6]

Indian traditional system of medicine (Ayurveda) being practiced since 1500 BC adopted a unique concept “Shodhana,” i.e., detoxification/biopurification of the body. There are five procedures under this heading. These procedures are believed to correct the root pathology.[7] Virechana (therapeutic purgation) is one such detoxification/biopurification technique that clearly blocks in terms of “flow of biological materials/pathways of tissue synthesis/signal flow, etc.” and also enhances tissue regeneration. Another important feature of Ayurveda is Apunarbhava chikitsa, i.e., prevention of recurrence. There is a branch of Ayurveda called Rasayana that deals with prevention and rejuvenation. To correct the root pathology and to prevent the recurrence, the therapy must act at the level of genetic expression. The present study makes an attempt to study the effect of Virechana karma (therapeutic purgation) followed by Rasayana (medication that correct root pathology and stimulates growth of healthy tissue) on molecular gene profile.

Normal regulation and expression

BRCA1 and BRCA2 are ubiquitously expressed with the highest levels found in thymus and testis. BRCA1 and BRCA2 are required for proliferation in early embryogenesis and are upregulated with the proliferation of breast epithelial cells during puberty and pregnancy.[8] Estrogen levels are high in both breast and ovarian tissues during these phases, suggesting that estrogen might stimulate this expression. In normal cells, BRCA1 and BRCA2 are nuclear proteins.[9] The expression of BRCA1 and BRCA2 increases in late G1 phase of the cell cycle.[10] In mitotic cells, BRCA1, BRCA2, and RAD51 interact and co-localize in a punctuated pattern in the nucleus during the S phase of the cell cycle.[11] BRCA1 function is regulated by phosphorylation; it is hyperphosphorylated during the late G1 and S phase and dephosphorylated in M phase.[12]

Functions of BRCA1

BRCA genes are essential for preserving chromosome structure, suggesting that, in their role as tumor suppressors, they behave as caretakers, suppressing genome instability.[13] BRCA1 may function as a scaffold in the assembly of a multiprotein complex, which is important in maintenance of genomic integrity by functioning in gene transcription, chromatin remodeling,[14] checkpoint activation,[15] and DNA damage repair.[16] When cells lack one of the repair proteins, they fail to repair the double-stranded DNA break correctly. This leads to genetic instability, gross chromosomal rearrangements, and accumulation of mutations. These events then trigger cell cycle checkpoints, resulting in permanent growth arrest or death of affected cells. If the checkpoints are inactivated by mutations, this leads to tumor genesis.[17]


  Materials and Methods Top


The study aims to evaluate the efficacy of therapeutic purgation (Virechana) and rejuvenation therapy (Rasayana) on molecular gene profiling of predisposed familial breast cancer patients through mRNA gene expression. The study was single group with a pretest and posttest analyses. Five subjects of familial breast cancer predisposition and fit for the procedure therapeutic purgation were considered in this study. Subjects enrolled for the study were administered therapies at KAHER's Shri BMK Ayurveda Mahavidyalaya and the gene expression studies were carried out at Karnataka Institute for DNA Research (KIDNAR), Karnataka University Dharwad. The demographic data of the subjects included in the study has been depicted in [Table 1].
Table 1: Demographic variables of 5 subjects

Click here to view


Subjects with sporadic breast cancer, associated with systemic disorders, were excluded from the study.

Intervention

Therapeutic purgation (Virechana): The procedure was administered under following steps:

  • Augmentation of digestion and metabolism (Deepana and Pachana): A poly herbal formulation (Hingwastaka choorna)[18] 5 g with warm water before food thrice daily till the attainment of proper appetite and digestion or maximum of 3 days
  • Unctuous saturation (Snehapana): Processed clarified butter (Kalyanaka Gritha[19]) administered in escalating order starting with 30 ml (1st day 30 ml, 2nd day 60 ml, and 3rd day 90 ml) till the attainment of proper unctuousness to body (assessed on the basis of stool quality, i.e., greasy stools and unctuousness over skin) or maximum of 7 days
  • Resting phase (Vishramakala): Once the individual attained unctuous saturation, the subjects were administered with Shudha Bala Taila[20] (processed oil) massage followed by sudation for 2 days. During these 2 days, subjects are served special diet
  • Therapeutic purgation: On the day of therapeutic purgation, subjects were administered oil (processed) massage followed by sudation. Then, they were administered purgative medicine (Trivrit lehya 25–40 g[21]) along with decoction of Triphala (combination of three fruits). Subjects were kept under medical supervision and advised to have enough water as and when they had loose motions. Once motions stopped, subjects were advised 2–3 days diet regimen to acclimatize to normal food
  • Rejuvenation therapy (Rasayana): Once the subjects were restored to normal diet, then all the subjects were administered rejuvenation therapy with a poly herbal formulation (Narasimha Rasayana[22]) in the dose of 12 g twice daily before food for 30 days.


Assessment: Genetic expression study

To see the gene expression, blood samples were drawn thrice (before commencement of intervention, after therapeutic purgation, and after rejuvenation therapy) in PAX Gene Blood RNA tubes (BD, Cat. No. 762165) under aseptic condition following SOPs and transported in cold chain 4°C to KIDNAR, Dharwad, and stored at −80°C. Whole RNA was isolated and quantified by PAX Gene Blood RNA Kit (Qiagen Cat. No 762174) method [Figure 1] and [Figure 2].
Figure 1: mRNA electrophoresis before treatment

Click here to view
Figure 2: mRNA electrophoresis after treatment

Click here to view


The Reverse Transcription Polymerase chain Reaction was carried out using high capacity cDNA Reverse Transcription Kit (Part no: 4368814, Applied Biosystems) for the quantitative conversion of total RNA in a single 20 μL reaction to single stranded cDNA.

The real-time polymerase chain reaction (qPCR) Power SYBR® Green PCR master mix (Part no: 4367659, Applied Bio systems) was used for qPCR analysis using SYBR® Green 1 Dye. 53.7°C for BRCA1 primers and 58°C for GAPDH primers were used to amplify the gene [Figure 3].
Figure 3: cDNA gel electrophoresis

Click here to view


Primer Sequence (5'-3')

  • BRCA1 Forward TTGTCAATCCTAGCCTTCCAAGAG
  • BRCA1 Reverse GCGCTTTGAAACCTTGAATGTAT
  • GAPDH Forward CGACCACTTTGTCAAGCTCA
  • GAPDH Reverse AGGGGTCTACATGGCAACTG.


Analysis

The qPCR-based BRCA1 gene expression results were analyzed for fold variation based on Ct values using the following formula: 2 (−ΔΔCt), where ΔCt is the Ct (GOI) – avg.(Ct (HKG)), GOI is the gene of interest, and HKG is the housekeeping gene.[23]


  Results and Discussion Top


The Panchakarma treatment therapeutic purgation (Virechana) was tried in five predisposed familial breast cancer patients. Gene expression analysis carried at baseline level revealed two categories, i.e., upregulation in four subjects and downregulation in one subject. The biopurification with therapeutic purgation followed by rejuvenation therapy (Narasimha Rasayana) provided diversified and in-conclusive results [Table 2], [Table 3] and [Figure 4],[Figure 5],[Figure 6],[Figure 7]. In one subject (S1), the upregulation (61.82) showed further increase (843.36) by therapeutic purgation and then decreased below the baseline level (11.3) in rejuvenation phase. In three subjects (S2, S3, and S5), the upregulated genes (1488.87, 15825.9, 19.16) showed down trend continuously till rejuvenation phase (1.92, 4.17, and 3.97) but not to downregulation. In another subject (S4) downregulated gene (−1) showed upregulation (237,900.70) continuously throughout the therapy which is in conformity of the proposed hypothesis, i.e., biopurification (therapeutic purgation) followed by rejuvenation leads to up regulation of tumor suppressor gene, which might be due to genomic stability in maintenance of genomic integrity in gene transcription, chromatin remodeling, checkpoint activation, DNA damage repair, and in remaining subjects where decreased expression was seen might be due to tachyphylaxis, i.e., acute decrease in the response to a drug after its administration, the expression of the protein is decreased to protect the cell.
Table 2: Fold variation of BRCA1 gene expression in different treatment intervals (n=5)

Click here to view
Table 3: Mean fold variation of BRCA1 gene expression in different treatment intervals

Click here to view
Figure 4: GAPDH raw data

Click here to view
Figure 5: GAPDH+/- assay

Click here to view
Figure 6: BRCA1 raw data

Click here to view
Figure 7: BRCA1+/- assay

Click here to view


Although the results are not uniform in all subjects, on the basis of individualized subject analysis, it may be stated that the biopurification (therapeutic purgation) therapy as well as rejuvenation therapy definitely influences gene expression. As the present study is exploratory, only BRCA1 is included, and hence, there is a need to include other oncogenes such as HER-2, Ras, P13K, AKT, c-myc, c-fos, cyclin D1, cyclin E, and tumor-suppressor genes such as BRCA2, p53, ATM, CHK2, PTEN, Rb, p27, APC, and p16 for definite results.


  Conclusion Top


The present study showed diversified gene expression in all the five subjects of the study.

  • Decrease of upregulated gene BRCA1 was seen in four subjects, i.e., S1, S2, S3, and S5, differently at different interval of treatment period. S1 showed decreased expression in rejuvenation phase and S2, S3, and S4 showed decreased expression continuously from the starting till the rejuvenation phase but did not down regulate completely
  • Reversal of downregulated gene to upregulation was seen in S4 subject.


With the available limited and diversified data, it may be concluded that therapeutic purgation followed by rejuvenation (Narasimha Rasayana) therapy exerted favorable effect on gene expression, but it is challenging to conclude at this stage because of smaller sample size.

Scope

The present study was conducted on small sample size due the lack of availability of subjects fulfilling inclusion criteria of. If study can be conducted on large population by doing multicentric or in the most prevalent area, it could give the evidence in the field of Ayurveda and clinical practice.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Shah R, Rosso K, Nathanson SD. Pathogenesis, prevention, diagnosis and treatment of breast cancer. World J Clin Oncol 2014;5:283-98.  Back to cited text no. 1
    
2.
Malvia S, Bagadi SA, Dubey US, Saxena S. Epidemiology of breast cancer in Indian women. Asia Pac J Clin Oncol 2017;13:289-95.  Back to cited text no. 2
    
3.
Andrea Mary F, Rajan A, Selvi R, Paul SF. A pilot study on screening for 185 delag mutation in breast cancer patients in a tertiary care center from South India. Sri Ramachandra J Med 2010;3:9-11.  Back to cited text no. 3
    
4.
Soumittra N, Meenakumari B, Parija T, Sridevi V, Nancy KN, Swaminathan R, et al. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India. Hered Cancer Clin Pract 2009;7:13.  Back to cited text no. 4
    
5.
Hartman AR, Ford JM. BRCA1 and p53: Compensatory roles in DNA repair. J Mol Med (Berl) 2003;81:700-7.  Back to cited text no. 5
    
6.
Metcalfe KA, Narod SA. Breast cancer prevention in women with a BRCA1 or BRCA2 mutation. Open Med 2007;1:144-6.  Back to cited text no. 6
    
7.
Vriddhajivakiya, Kashyapa Samhita, Redacted by Vatsya, Edited with English Translation, Commentary, P. V. Tiwari, Chaukambba Viswabharthi 2/7. Reprint edition. Varnasi: Siddisthana; 2002. p. 266.  Back to cited text no. 7
    
8.
Rajan JV, Marquis ST, Gardner HP, Chodosh LA. Developmental expression of Brca2 colocalizes with Brca1 and is associated with proliferation and differentiation in multiple tissues. Dev Biol 1997;184:385-401.  Back to cited text no. 8
    
9.
Bertwistle D, Swift S, Marston NJ, Jackson LE, Crossland S, Crompton MR, et al. Nuclear location and cell cycle regulation of the BRCA2 protein. Cancer Res 1997;57:5485-8.  Back to cited text no. 9
    
10.
Gudas JM, Li T, Nguyen H, Jensen D, Rauscher FJ 3rd, Cowan KH. Cell cycle regulation of BRCA1 messenger RNA in human breast epithelial cells. Cell Growth Differ 1996;7:717-23.  Back to cited text no. 10
    
11.
Chen J, Silver DP, Walpita D, Cantor SB, Gazdar AF, Tomlinson G, et al. Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol Cell 1998;2:317-28.  Back to cited text no. 11
    
12.
Timothy K. MacLachlan and Wafik El-Deiry. Functional Interactions Between BRCA1 and the Cell Cycle. Madame Curie Bioscience Database. https://www.ncbi.nlm.nih.gov/books/NBK6004/. [Last accessed on 2021 Mar 20].  Back to cited text no. 12
    
13.
Kinzler KW, Vogelstein B. Cancer-susceptibility genes. Gatekeepers and caretakers. Nature 1997;386:761-3.  Back to cited text no. 13
    
14.
Paull TT, Cortez D, Bowers B, Elledge SJ, Gellert M. Direct DNA binding by Brca1. Proc Natl Acad Sci U S A 2001;98:6086-91.  Back to cited text no. 14
    
15.
Hsu LC, White RL. BRCA1 is associated with the centrosome during mitosis. Proc Natl Acad Sci U S A 1998;95:12983-8.  Back to cited text no. 15
    
16.
Deng CX, Wang RH. Roles of BRCA1 in DNA damage repair: A link between development and cancer. Hum Mol Gen 2003;Apr1:12.  Back to cited text no. 16
    
17.
Khanna KK, Jackson SP. DNA double-strand breaks: Signaling, repair and the cancer connection. Nat Genet 2001;27:247-54.  Back to cited text no. 17
    
18.
Broca P. Traite Des Tumeurs. Paris: Published by P. Asselin; 1866.  Back to cited text no. 18
    
19.
Acharya Vagbhata's Asthangahridaya. Editor Pt. Bhisagacharya Harishastri Paradkar. 16/10 12. Varanasi: Chaukambha Prakashan,; 2009. p. 702.  Back to cited text no. 19
    
20.
Nishthesgwar K, Vidyanath R. Sahasra yogam, Taila prakarna. Varanasi, Chowkhambha Sanskrit Series Office. 2nd ed., 2008. p. 110.  Back to cited text no. 20
    
21.
Agnivesha, Charak Samhita. Editor Vaidya Jadavaji Trikamaji Acharya. Varanasi, Chaukambha Prakashan; 2010. p. 663.  Back to cited text no. 21
    
22.
Acharya Vagbhata's Asthangahridaya. Editor Pt Bhisagacharya Harishastri Paradkar. Varanasi: Chaukambha Prakashan; 2009. p. 938-39.  Back to cited text no. 22
    
23.
Kulkarni SS, Kulkarni BB, Vandana T, Kulkarni SS, Kadakol GS, Modak H. Expression profiling of brca1 gene in familial breast cancer in India. Afr J Biotechnol 2012;11:9123-26.  Back to cited text no. 23
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results and Disc...
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed767    
    Printed8    
    Emailed0    
    PDF Downloaded83    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]